View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_low_40 (Length: 229)
Name: NF10538_low_40
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_low_40 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 11269764 - 11269986
Alignment:
| Q |
7 |
gtaaacactcaccacaaatttcattgnnnnnnnagtgatgtgttatgatatgatatgtttctgacttgccactaaggctttctatatatggctaccaata |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11269764 |
gtaaacactcaccacaaatttcattgtttttttagtgatgtgttatgatatgatatgtttctgacttgccactaaggctttctatatatggctaccaata |
11269863 |
T |
|
| Q |
107 |
tttcatacattaattattttatgcatagaacatattaactagctcaacttgacttatcattgctgtttaatttaatagtactatgataatggttgcattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11269864 |
tttcatacattaattattttatgcatagaacatattaactagctcaacttgacttatcattgctgtttaatttaatagtactatgataatggttgcattg |
11269963 |
T |
|
| Q |
207 |
ttgcgccgatttagtgcttggac |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11269964 |
ttgcgccgatttagtgcttggac |
11269986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University