View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10538_low_46 (Length: 218)
Name: NF10538_low_46
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10538_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 20 - 174
Target Start/End: Original strand, 55071056 - 55071210
Alignment:
| Q |
20 |
gactcaacataattggctacataaacatgtaagatgtactctattnnnnnnntgatcgacttcgttgaaggaagaaaaaataaactagtcaaagctacta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
55071056 |
gactcaacataattggctacataaacatgtaagatgtactctattaaaaaaatgatcgacttcgttgaagaaaaaaaaaaaaaactagtcaaagctacta |
55071155 |
T |
 |
| Q |
120 |
ttattagcatctgtttccacggtaaaaaggaacccaacctaaacaaaattcacaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55071156 |
ttattagcatctgtttccacggtaaaaaggaacccaacctaaacaaaatttacaa |
55071210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University