View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10538_low_51 (Length: 204)

Name: NF10538_low_51
Description: NF10538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10538_low_51
NF10538_low_51
[»] chr5 (1 HSPs)
chr5 (107-193)||(14003076-14003162)


Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 107 - 193
Target Start/End: Complemental strand, 14003162 - 14003076
Alignment:
107 tgagctttaaaccttccacaccaattgaagtagcttcttatcctcacttgcattttttcccctcatcattattttatccctttgctt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
14003162 tgagctttaaaccttccacaccaattgaagtagcttcttatcctcacttgcattttttcccctcatcattattttatccttttgctt 14003076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University