View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_14 (Length: 328)
Name: NF10539_high_14
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 19 - 320
Target Start/End: Complemental strand, 46795101 - 46794800
Alignment:
| Q |
19 |
gtgtagcagtggaagaatgcaacaagaagaaattaggtaccctgggcctggtgcagattcaacaaatactcaacaaatgctgcaacaattgatgtcatct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46795101 |
gtgtagcagtggaagaatgcaacaagaagaaattaggtaccctgggcctggtgcagattcaacaaatactcaacaaatgctgcaacaattgatttcatct |
46795002 |
T |
 |
| Q |
119 |
tcaacatcacctgctgatagtactgaaactgaggcttatgcaagatggcgtcagcttcttcaacttcagacctatagtaacccttcttttcataatcatc |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46795001 |
tcaacatcacctgttgatagtactgaaactgaggcttatgcaagatggcgtcagcttcttcaacttcagacctatagtaacccttcttttcataatcatc |
46794902 |
T |
 |
| Q |
219 |
ataacctattggatagtgaaatacctagagatcatggtggatttaatgtgattgaggaatccattatgattaaaaggaacatgatgtctgctacttcttc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46794901 |
ataacctattggatagtgaaatacctagagatcatggtggatttaatgtgattgaggaatccattatgattaaaaggaacatgatgtctgctacttcttc |
46794802 |
T |
 |
| Q |
319 |
tc |
320 |
Q |
| |
|
|| |
|
|
| T |
46794801 |
tc |
46794800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University