View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_17 (Length: 321)
Name: NF10539_high_17
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 36 - 144
Target Start/End: Original strand, 17458153 - 17458261
Alignment:
| Q |
36 |
aatatgtgtttttattttaagtaggtcatttttcagactaagtgtatattattcgatttgaagaattaatcttttaaagaaaaggtgtaatgtttgacaa |
135 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
17458153 |
aatatgtgtttttattttaacaagatcatttttcagactaagtgtatattattcgatttgaagaattaatctttaaaagaaaagaagtaatgtttgacaa |
17458252 |
T |
|
| Q |
136 |
ttcatgcaa |
144 |
Q |
| |
|
||||||||| |
|
|
| T |
17458253 |
ttcatgcaa |
17458261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 250 - 312
Target Start/End: Original strand, 17459464 - 17459527
Alignment:
| Q |
250 |
taaatgaagata-gatacatatatcgccccctttgtatcgtatcattgcttccatcaccctatg |
312 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17459464 |
taaatgaagataagatacatatatctccccctttgtatcgtatctttgcttccatcaccctatg |
17459527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University