View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_19 (Length: 298)
Name: NF10539_high_19
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 32837603 - 32837329
Alignment:
| Q |
1 |
tcccatatgcttccttcctctctgccgaaaacgtgattgctgaaagtagctttgtgccaagccatcaatcttctt-ttctttgtgtcacttgcttccnnn |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| || | || |||||||||||||||||| |
|
|
| T |
32837603 |
tcccatatgcttccttcctctctgccgaaaacgtgattgctgaaagtcgctttgtgccaagccgtcaatcctcctcttatttgtgtcacttgcttccttt |
32837504 |
T |
 |
| Q |
100 |
nnnnacaggttcaggtaacctagctagtttcttt----tctttcacgggtcaacaccaaaatgattgggtcaaagcccatttgtttttatttttcta-tt |
194 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
32837503 |
tt--ataggttcaggtaacctagctagtttctttcttttctttcacgagtcaacaccaaaatggttgggtcaaagcccatttgtttttatttttctattt |
32837406 |
T |
 |
| Q |
195 |
tccaattgccaagcatatgccgtaagtgtggctatatgatggctatatgataattaagccatgataattttttagcttcactcttaag |
282 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32837405 |
tccaattgccaagcatatgccgtaagtg-----------tggctatatgataattaagccatgataaatttttagcttcactcttaag |
32837329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 167 - 234
Target Start/End: Complemental strand, 2371764 - 2371696
Alignment:
| Q |
167 |
aaagcccatttgtttttatttttctattt-ccaattgccaagcatatgccgtaagtgtggctatatgat |
234 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2371764 |
aaagcccatttgtttttattttactattttccaattgccaagcatataccgtaagtgtggctatatgat |
2371696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 3 - 45
Target Start/End: Complemental strand, 2371928 - 2371886
Alignment:
| Q |
3 |
ccatatgcttccttcctctctgccgaaaacgtgattgctgaaa |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2371928 |
ccatatgcttccttcctctctgccgaaaacgtgattgccgaaa |
2371886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University