View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_21 (Length: 290)
Name: NF10539_high_21
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 188 - 270
Target Start/End: Complemental strand, 31884108 - 31884026
Alignment:
| Q |
188 |
cttcaaaagtgagtgtataagtgtttcgaatacccctccaaaatctttgatactctctaacaaaagaatgtttggatggacaa |
270 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31884108 |
cttcaaaagtgattgtataagtgtttcgaatacccctccaaaatcttttatactctctaacaaaagaatgtttggatggacaa |
31884026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 105 - 172
Target Start/End: Complemental strand, 9069592 - 9069523
Alignment:
| Q |
105 |
tggagtatttatgaatagtaaata--cggtgttgtatttgtgtgaacaaatttgtgtccatttatcattt |
172 |
Q |
| |
|
||||||||||||||| |||| ||| ||| ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
9069592 |
tggagtatttatgaacagtacatatacggagttgtatttgtgtcaacaaatttgtgtttgtttatcattt |
9069523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 185
Target Start/End: Original strand, 14245268 - 14245327
Alignment:
| Q |
126 |
atacggtgttgtatttgtgtgaacaaatttgtgtccatttatcatttctctaaaataaaa |
185 |
Q |
| |
|
|||||||||||||||||||| || | ||||||||||| |||||| | ||||||| ||||| |
|
|
| T |
14245268 |
atacggtgttgtatttgtgtcaagagatttgtgtccagttatcaatactctaaattaaaa |
14245327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University