View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_25 (Length: 284)
Name: NF10539_high_25
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 30 - 275
Target Start/End: Complemental strand, 13731824 - 13731576
Alignment:
| Q |
30 |
tatgttgcctgtatttgggctcaaataccattacttgatttgagttctagtttatttactact---tttcttttcaaccattgcttatgaattctttgcg |
126 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13731824 |
tatgttgcttgtatttgggctcaaataccattacttgatttgagttctagtttatttactactacttttcttttcaaccattgcttatgaattctttgcg |
13731725 |
T |
|
| Q |
127 |
tagaagagaacatatgaatatgaatgaggnnnnnnnngataaaagatgtctagaattcaaggaattaataaaactgctcacccaacatgataagcttatt |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13731724 |
tagaagagaacatatgaatatgaatgaggaaaaaaaagataaaagatgtctagaattcaaggaattaataaaactgctcacccaacatgataagcttatt |
13731625 |
T |
|
| Q |
227 |
ccattctttcccctttaagtagagtttttgctcaataattagttcatct |
275 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
13731624 |
ccattctttcccctttaagttgagtttttgctcaataattagttgatct |
13731576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University