View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_27 (Length: 259)
Name: NF10539_high_27
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 42 - 126
Target Start/End: Complemental strand, 32146410 - 32146326
Alignment:
| Q |
42 |
tatgcagtgtcatattgatttggactattcattttaacagtgtcgttagttatactcgttcctttggttacgttgtcgagtacaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32146410 |
tatgcagtgtcatattgatttggactattcattttaacagtgtcgttagttatactcgttcctttggttacgttgttgagtacaa |
32146326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 178 - 246
Target Start/End: Complemental strand, 32146281 - 32146213
Alignment:
| Q |
178 |
ggaccacagtgaataaactcgaaggccacgccaatttgctcattttcaacgctgcctgcttctttgtct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32146281 |
ggaccacagtgaataaactcgaaggccacgccaatttgctcattttcaacgctgcctgcttctttgtct |
32146213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University