View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_31 (Length: 250)
Name: NF10539_high_31
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 14360059 - 14360281
Alignment:
| Q |
16 |
ttgtccatgacaagcacgctggaaacaaacattggaatgacaatttaccaaaagtaatgttctgatgcacagtcagcttgccttcaagaagaaagaatat |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14360059 |
ttgtccatgacaagcacgctgaaaacaaacattggaatgacaatttaccaaaagcaatgttctgatgcacagtcagcttgccttcaagaagcaagaatat |
14360158 |
T |
 |
| Q |
116 |
ttcagtttgcaaccaatctaatcaattgagtcttgttagtcaattttatattctcagtacaagattgaaaattatatcagtcatttcagcagtaaaacaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |||||| |||||||||||| |||| ||||||||||||||||||| | |
|
|
| T |
14360159 |
ttcagtttgcaaccaatctaatcaattgagtcttgtttgtcaattttatcttcccagtactagattgaaaattgtatcggtcatttcagcagtaaaacga |
14360258 |
T |
 |
| Q |
216 |
caacatattggttccatatcctt |
238 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
14360259 |
caacatattggttccaaatcctt |
14360281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University