View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_35 (Length: 243)
Name: NF10539_high_35
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 8 - 133
Target Start/End: Complemental strand, 5447828 - 5447701
Alignment:
| Q |
8 |
atgcacttcacccccactcactcaccaccccc--atgcatgattaccaacacctacctggcaagtggcaacttcacctcccttcattttcatatgtttgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5447828 |
atgcacttcacccccactcactcaccacccccccatgcatgattgccaacacctacctggcaagtggcaacttcacctcccttcattttcatatgtttgt |
5447729 |
T |
 |
| Q |
106 |
caacaacttacaagtatcaaacaataat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5447728 |
caacaacttacaagtatcaaacaataat |
5447701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University