View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_36 (Length: 242)
Name: NF10539_high_36
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 2813908 - 2813686
Alignment:
| Q |
2 |
tgatttttagattatataatttgaaatattataatgcatgcgagaaactttgagggtgaaaaaagaaacactctttaaactaataannnnnnngggctga |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2813908 |
tgatttttagattatataatttgaagtattataatgcatgcgagaaactttgagggtgaaaaaagaaacactctttaaactaataatttttttgggctga |
2813809 |
T |
 |
| Q |
102 |
gcggcaaactggcaatggtcaattagtccaagaaaatattacaccgnnnnnnnnnnnaaga--agatattgagatttgaagagcttcatctttagctcaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813808 |
gcggcaaactggcaatggtcaattagtccaagaaaatattacaccg-ttttttttttaagaagagatattgagatttgaagagcttcatctttagctcaa |
2813710 |
T |
 |
| Q |
200 |
tggtattaaaaaccgcaccactct |
223 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
2813709 |
tggtattaaaaaccacaccactct |
2813686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University