View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_40 (Length: 235)
Name: NF10539_high_40
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 220
Target Start/End: Original strand, 52471987 - 52472188
Alignment:
| Q |
19 |
atataggctgagtgtggtggtacagtgagacgtgttttgtgatctcttttaacaccgtatagtaactgtcatgtctgcttgctgctgtttagacagaaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471987 |
atataggctgagtgtggtggtacagtgagacgtgttttgtgatctcttttaacaccgtatagtaactgtcatgtctgcttgctgctgtttagacagaaac |
52472086 |
T |
 |
| Q |
119 |
tcacccttcttttgttagccaatttaaaaccccatccttcttagtaacaccattcagcaaggtatagaaggaggcagtctcacccgtcgattgttgccta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52472087 |
tcacccttcttttgttagccaatttaaaaccccatccttcttagtaacaccattcagcaaggtatagaaggaggcagtctcatccgtcgattgttgccta |
52472186 |
T |
 |
| Q |
219 |
tg |
220 |
Q |
| |
|
|| |
|
|
| T |
52472187 |
tg |
52472188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University