View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_high_43 (Length: 217)
Name: NF10539_high_43
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_high_43 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 3745026 - 3745242
Alignment:
| Q |
1 |
tcttccttaatatctgcaggagtagcagccattgccttggcatctctaacataggatctagttggagcattgtgtgatgatgtcttctccacattgtcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3745026 |
tcttccttaatatctgcaggagtagcagccattgccttggcatctctaacataggatctagttggagcattgtgtgatgatgtcttctccatattgtcat |
3745125 |
T |
 |
| Q |
101 |
ctgaaagatccatcatctggtgcaaagcgtgtagcactggagcatctaaacccatcaacctgaaatccattctcacactttttcttgattttcttctact |
200 |
Q |
| |
|
||||||| |||||||| ||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3745126 |
ctgaaaggtccatcatttggtgaagagcgtgtagcactggagcatccaaacccatcaacctgaaatccattctcacactttttcttgattttcttctact |
3745225 |
T |
 |
| Q |
201 |
ttgatgaaaaatgatat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3745226 |
ttgatgaaaaatgatat |
3745242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University