View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_low_16 (Length: 373)
Name: NF10539_low_16
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 3 - 363
Target Start/End: Original strand, 52472170 - 52472529
Alignment:
| Q |
3 |
ccgtcgattgttgcctatgttttgatatgtctctattttcctttatgctgagagcttctcaacatatttttccaattcaccacgacctttccgatggtct |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472170 |
ccgtcgattgttgcctatgttttgatatgtctctattttcctttatgcttagagcttctcaacatatttttccaattcaccacgacctttccgatggtct |
52472269 |
T |
 |
| Q |
103 |
gcaagcaacccactctaaaaataatgtcaattccacttaagtattat---acaaaggcttcaatgtttacctctacctcaccaaacagaatcaccg--tt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52472270 |
gcaagcaacccactctaaaaataatgtcaattccacttaagtattattacacaaaggcttcaatgtttacctctacctcaccaaacagaatcaccgtttt |
52472369 |
T |
 |
| Q |
198 |
ttttagcgttttccattggttgtgactctatgatcatctccttctttcttctaatagatcaatgtctagtagtagtagatatatcttcttcatctttcca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52472370 |
ttttagcgttttccattggttgtgactctatgatcatctccttctttcttctaatagatcaatgtc------tagtagatatatcttcttcatctttcca |
52472463 |
T |
 |
| Q |
298 |
actttcccacatatactttccttatattgggcttcctagggcccaaatccaacactttttcctttg |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472464 |
actttcccacatatactttccttatattgggcttcctagggcccaaatccaacactttttcctttg |
52472529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University