View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_low_23 (Length: 327)
Name: NF10539_low_23
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 93 - 272
Target Start/End: Original strand, 45681878 - 45682062
Alignment:
| Q |
93 |
gaaccttagtcattgaaggtaggagtcaataggtatgtcaagttctcaaattgaaccgtcctaataatc-----aagacagacaatagttgagacaaatc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45681878 |
gaaccttagtcattgaaggtaggagtcaataggtatgtcaagttctcaaattgaaccgtcctaataatcaaatcaagacagacaatagttgagacaaatc |
45681977 |
T |
|
| Q |
188 |
taatccaaaatcacttgtataatatgctgtacagtatattataattaatttgtcttatcaatgctgagctgggattgtttatata |
272 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45681978 |
taatccaaaatcacttgtacaatatgctgtacagtatattataattaatttgtcttatcaatgctgagctgggattgtttatata |
45682062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 45681756 - 45681824
Alignment:
| Q |
1 |
gtaaggtgccaccttaattcttgtttgaaaaaatgttgtacaagaaacatgcatgtatgggaaggactg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45681756 |
gtaaggtgccaccttaattcttgtttgaaaaaatgttgtacaagaaacatgcatgtatgggaaggactg |
45681824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University