View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_low_29 (Length: 303)
Name: NF10539_low_29
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 44318245 - 44318447
Alignment:
| Q |
1 |
cgcagatttccaaattctcagagttgtaggacaaggtgcctttggcaaagtcttcatggtcagnnnnnnnggtgcagattcaaattcaaattcttcaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
44318245 |
cgcagatttccaaattctcagagttgtaggacaaggtgcctttggcaaagtcttcatggtcagaaaaaaaggtggagattcaaattcaaattcttcaaac |
44318344 |
T |
 |
| Q |
101 |
ggaatattcgccatgaaggttatgagaaaagacaacatcattaagaaaaatcatgttgattatatgaaagctgagagagatattcttactaaagttcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44318345 |
ggaatattcgccatgaaggttatgagaaaagacaacatcattaagaaaaatcatgttgattatatgaaagctgagagagatattcttactaaagttcttc |
44318444 |
T |
 |
| Q |
201 |
atc |
203 |
Q |
| |
|
||| |
|
|
| T |
44318445 |
atc |
44318447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University