View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_low_32 (Length: 292)
Name: NF10539_low_32
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 7 - 278
Target Start/End: Complemental strand, 28158544 - 28158266
Alignment:
| Q |
7 |
aacctgtgcgagagggaaagatttagcgcatggatattattggatactctacatcacaaccggacccgttgccaaatgattatctacttttaggattagg |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28158544 |
aacctgtgggagagggaaagatttagcgcatagatattattggatactctacatcacagccggacccgttgccaaaagattatctacttttaggattagg |
28158445 |
T |
|
| Q |
107 |
acacactcagcccaccttttcaggatctaaattatacatataatgatagttgtatgatttcaattcattttctacttgtttgtttgttagatatacttcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28158444 |
acacactcagcccaccttttcaggatctaaattatacatataatgatagttgtatgatttcaattcattttctacttgtt----tgttagatatacttcc |
28158349 |
T |
|
| Q |
207 |
atatcagttcataatgtcaaaatt-------gttaatat----tctaaattagatcttgagatcttcgataattctgcttgtc |
278 |
Q |
| |
|
|| ||| || |||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28158348 |
atctcaattgataatgtcaaaattaataagactgaatattctatctaaattagatcttgagatcttcgataattctgcttgtc |
28158266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University