View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_low_38 (Length: 283)
Name: NF10539_low_38
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 36440546 - 36440336
Alignment:
| Q |
18 |
actaccaaggtaccaatttttcaatttttagttgtatgtctcaatcacactcctttactcacaggacccatatataacaactcatgcatattcatcccca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36440546 |
actaccaaggtaccaatttttcaatttttagttgtatgtctcaatcgcactcctttactcacaggacccatatataacaactcatgcatattcatcccca |
36440447 |
T |
 |
| Q |
118 |
gatcagcacgcattctcatcattaatgataaaagtaactcaaattcaacttgttcatttctaatccttttcactcatcaaatgctattcataacaccatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36440446 |
gatcagcacgcattctcatcattaatgataaaagtaactcaaattcaacttgttcatttctaatccttttcactcatcaaatgctattcataacaccatg |
36440347 |
T |
 |
| Q |
218 |
aaagaggttcc |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
36440346 |
aaagaggttcc |
36440336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University