View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_low_39 (Length: 279)
Name: NF10539_low_39
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 37762803 - 37762554
Alignment:
| Q |
19 |
ccatgtgcaagttgccattgtttagcacgaagtacattacgaataacaacattgtaagcgttaagggaaggtgaatattgagctatttcgttcatccaat |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37762803 |
ccatgtgcaagttgccattgtttcgcacgaagtacattgcgaataacaacattgtaaacgttaagggaaggtgaatattgagctatttcgttcatccaat |
37762704 |
T |
 |
| Q |
119 |
cgagaattgcgagggagcgttgccaatcgggttcgcgggagagaattgaaaccatgaaacgaattgaaagttgtctgccattgtaaggggacaatatgga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37762703 |
cgagaattgcgagggagcgttgccaatcgggttcgcgggagagaattgaaatcatgaaacgaattgaaagttgtctgccattgtaaggggacaatatgga |
37762604 |
T |
 |
| Q |
219 |
gtagagttgttcgatgttttgggcttgtgcgattgaggttagtagttcat |
268 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37762603 |
gtagagttgttcgatgttttgggtttgtgcgattgaggttagtagttcat |
37762554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University