View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10539_low_60 (Length: 230)

Name: NF10539_low_60
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10539_low_60
NF10539_low_60
[»] chr7 (1 HSPs)
chr7 (25-174)||(43579275-43579424)


Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 25 - 174
Target Start/End: Complemental strand, 43579424 - 43579275
Alignment:
25 gaacaaaaattttagaaatttttataggacaaaaatatatctttagtccaaaataaatatgttgataaacaaataatgggaataaataaatctttcatat 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43579424 gaacaaaaattttagaaatttttataggacaaaaatatatctttagtccaaaataaatatgttgataaacaaataatgggaataaataaatctttcatat 43579325  T
125 cnnnnnnnnagaaagaaaaaatagattttaatctccattttaaaagtgtc 174  Q
    |        |||||||||||||||||||||||||||||||| ||||||||    
43579324 cttttttttagaaagaaaaaatagattttaatctccattttgaaagtgtc 43579275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University