View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10539_low_61 (Length: 227)
Name: NF10539_low_61
Description: NF10539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10539_low_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 8 - 187
Target Start/End: Complemental strand, 34129686 - 34129513
Alignment:
| Q |
8 |
tacgggcacgtttcatgatgataccaaagttcaacacttcaaccaaatttgagcagcatatattcattgcattataatgtcaacaaaggcgtatacctct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
34129686 |
tacgggcacgtttcatgatgataccaaagttcaacacttcaaccaaatttgagcaacatatattcattgcattataatgtcaacaaaggcatataccgct |
34129587 |
T |
|
| Q |
108 |
ttcaccactgccgccaactaaagcattttcccatcatcaggtgaagaagaggtaagtaaataaatgcatacacaaacaaa |
187 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34129586 |
ttcacgactgccgccaactaaagcattttccc---atcaggt---gaagaggtaagtaaataaatgcatacacaaacaaa |
34129513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University