View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1053_low_5 (Length: 334)
Name: NF1053_low_5
Description: NF1053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1053_low_5 |
 | |
|
| [»] scaffold1861 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1861 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: scaffold1861
Description:
Target: scaffold1861; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 268 - 327
Target Start/End: Complemental strand, 1289 - 1230
Alignment:
| Q |
268 |
aaaatatcaatacttttttcaatttatatccctgaccccaagtcaatctctttcatctca |
327 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1289 |
aaaatatcaatacttttttcaatttacatccctgaccccaagtcaatctctttcatctca |
1230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 191 - 239
Target Start/End: Original strand, 41699370 - 41699418
Alignment:
| Q |
191 |
ctctctctcaaccaaattaacatttgtttttagtgtgattttataagtt |
239 |
Q |
| |
|
|||||||| ||| |||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
41699370 |
ctctctcttaacaaaattaacgtttgattttagagtgattttataagtt |
41699418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University