View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1053_low_6 (Length: 317)
Name: NF1053_low_6
Description: NF1053
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1053_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 87 - 220
Target Start/End: Complemental strand, 10187589 - 10187456
Alignment:
| Q |
87 |
cacagaacaccaacattttttaagggccccgaggcaacatgcagaatgcttaataaagaacaaaatgcaggcagaaaaaagtagaataaaaaccacagga |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10187589 |
cacagaacaccaacattttttaagggccccgaggcaacatgcagaatgcttaataaagaacaaaatgcaggcagaaaaaagtagaataaaaaccacagga |
10187490 |
T |
 |
| Q |
187 |
gtagaacgtacatctcggctcgttgtcttcactg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10187489 |
gtagaacgtacatctcggctcgttgtcttcactg |
10187456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 87 - 163
Target Start/End: Complemental strand, 28933306 - 28933230
Alignment:
| Q |
87 |
cacagaacaccaacattttttaagggccccgaggcaacatgcagaatgcttaataaagaacaaaatgcaggcagaaa |
163 |
Q |
| |
|
|||| |||||||| |||||||| ||| || |||| ||| |||||||| | ||||| ||||||||||||||| ||||| |
|
|
| T |
28933306 |
cacacaacaccaatattttttatggggcctgaggaaacctgcagaatacataatatagaacaaaatgcaggtagaaa |
28933230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University