View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10540_low_17 (Length: 207)
Name: NF10540_low_17
Description: NF10540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10540_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 190
Target Start/End: Complemental strand, 42176092 - 42175916
Alignment:
| Q |
16 |
tagggctagttggttatattacttaacgtcgtgtaagacatacatatgacatgtcttcctaaacacttagaatatattt-aaaagaatcttttgaaatca |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
42176092 |
tagggctagttggttatattccttaacgtcgtgtaagacatacatatgacatgtcttcctaaacacttggaatatatttaaaaagaatcttttgaaatca |
42175993 |
T |
 |
| Q |
115 |
tttgac-aaaaaagattttgctaaaaagaggtttatgttacctagaagtaagaacaaatataagcagagttaattag |
190 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42175992 |
tttgacaaaaaaagattttgctaaaaagaggtttatgttacctagaagtaagaacaaatataagcagagttaattag |
42175916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University