View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10540_low_2 (Length: 411)
Name: NF10540_low_2
Description: NF10540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10540_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 7 - 406
Target Start/End: Original strand, 8124555 - 8124954
Alignment:
| Q |
7 |
gtttggacaacacatcaccaacatttgcttctgctatgcaaaattctgttccagcccttacctttctcatggctgtgatattaaggcaagctataacact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124555 |
gtttggacaacacatcaccaacatttgcttctgctatgcaaaattctgttccagcccttacctttctcatggctgtgatattaaggcaagctataacact |
8124654 |
T |
|
| Q |
107 |
ttaactctagagcttaaagttcagaccttttttgatgatatattcataaacttgttcaattatgtatgtaaagtgcagatatgagagcttgcacttaaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124655 |
ttaactctagagcttaaagttcagaccttttttgatgaaatattcataaacttgttcaattatgtatgtaaagtgcagatatgagagcttgcacttaaat |
8124754 |
T |
|
| Q |
207 |
aggataaatggtatggccaaggttcttggagtacttgcttctgttggaggagcttcaatcattaccctttacaagggacctaccatttatgctccacatt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8124755 |
aggataaatggtatggccaaggttcttggagtacttgcttctgttggaggagcttcaatcattaccctttacaagggacctaccatttatgctccacatt |
8124854 |
T |
|
| Q |
307 |
tagcactacatcaaggacaaattttcttgtctgcatttgaggatgccaatgggaaaaacttgaacttgggtggcatccttctctttggtcattgtctgtg |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8124855 |
tagcactacatcaaggacaaattttcttgtctgcatttgaggatgccaatgggaaaaacttgaacttgggtggcatccttctctttggtcattgtttgtg |
8124954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 9 - 79
Target Start/End: Complemental strand, 52730515 - 52730445
Alignment:
| Q |
9 |
ttggacaacacatcaccaacatttgcttctgctatgcaaaattctgttccagcccttacctttctcatggc |
79 |
Q |
| |
|
|||||||||||||| ||||| ||||| || ||||| || |||||||| |||||| |||| ||| ||||||| |
|
|
| T |
52730515 |
ttggacaacacatctccaacctttgcatcagctatacagaattctgtaccagccattacatttgtcatggc |
52730445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University