View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10540_low_7 (Length: 299)
Name: NF10540_low_7
Description: NF10540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10540_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 101 - 289
Target Start/End: Complemental strand, 29847471 - 29847283
Alignment:
| Q |
101 |
agtttgagagattcttgagatgcaaagtctgagatcagaagctgagatagtgaaagaagaaggtatgaagcaaaagagagtggcaatggtgcagagaagt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29847471 |
agtttgagagattcttgagatacaaagtctgagatcagaagctgagatagtgaaagaagaaggtatgaagcaaaagagagtggcaatggtgcagagaagt |
29847372 |
T |
|
| Q |
201 |
agaagagttgtgaggaaaagtttgtgttctgcagcatagtttcttgatgaccaaagaaagagcttcttctctttgtctttgatgtccat |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29847371 |
agaagagttgtgaggaaaagtttgtgttctgcagcatagtttcttgatgaccaaagaaagagcttcttctctttgtctttgatggccat |
29847283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 17 - 50
Target Start/End: Complemental strand, 29847552 - 29847519
Alignment:
| Q |
17 |
attggtaatgagtttttcatggacaatggaagag |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29847552 |
attggtaatgagtttttcatggacaatggaagag |
29847519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University