View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10541_high_10 (Length: 214)

Name: NF10541_high_10
Description: NF10541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10541_high_10
NF10541_high_10
[»] chr6 (1 HSPs)
chr6 (16-199)||(28716535-28716714)


Alignment Details
Target: chr6 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 28716535 - 28716714
Alignment:
16 aaggtcacatttacaagctttaaacgaagcttcaaaatttggggaaatgttggtgttcttctttagaggacaagaacaacaacccaaagnnnnnnnnnnn 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||               
28716535 aaggtcacatttacaagctttaaacgaagcttcaaaatttggggaaacattggtgttcttctttagaggacaagaacaacaacccaaagttttttttt-- 28716632  T
116 nataagaaagaacaacaacccaaagttaatcacaagttaaatactcttcttacagctgatcgaaagcttcaatgggtaatttct 199  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
28716633 --taagaaagaacaacaacccaaagttaatcacaagttaaatactcttcttacagctgatcgaaagcttcaatgtgtaatttct 28716714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University