View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10541_high_10 (Length: 214)
Name: NF10541_high_10
Description: NF10541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10541_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 28716535 - 28716714
Alignment:
| Q |
16 |
aaggtcacatttacaagctttaaacgaagcttcaaaatttggggaaatgttggtgttcttctttagaggacaagaacaacaacccaaagnnnnnnnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28716535 |
aaggtcacatttacaagctttaaacgaagcttcaaaatttggggaaacattggtgttcttctttagaggacaagaacaacaacccaaagttttttttt-- |
28716632 |
T |
 |
| Q |
116 |
nataagaaagaacaacaacccaaagttaatcacaagttaaatactcttcttacagctgatcgaaagcttcaatgggtaatttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28716633 |
--taagaaagaacaacaacccaaagttaatcacaagttaaatactcttcttacagctgatcgaaagcttcaatgtgtaatttct |
28716714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University