View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10541_low_11 (Length: 347)
Name: NF10541_low_11
Description: NF10541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10541_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 16 - 227
Target Start/End: Complemental strand, 41825154 - 41824943
Alignment:
| Q |
16 |
catggaccacatgcatgtatcattggtgttatgaaattcaacatcaatattttaaagatgaagaatagagcttttgattttgataatgacatggtgaatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825154 |
catggaccacatgcatgtatcattggtgttatgaaattcaacatcaatattttaaagatgaagaatagagcttttgattttgataatgacatggtgaatg |
41825055 |
T |
|
| Q |
116 |
gtgtgaacctgacacacactttcgttgtttttctttgattttggtactacactgatatactagtatgctgcttatatagttcaagcttgtgaaaacaatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825054 |
gtgtgaacctgacacacactttcgttgtttttctttgattttggtactacactgatatactagtatgctgcttatatagttcaagcttgtgaaaacaatg |
41824955 |
T |
|
| Q |
216 |
aagcggtgacgg |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
41824954 |
aagcggtgacgg |
41824943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University