View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10541_low_23 (Length: 257)
Name: NF10541_low_23
Description: NF10541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10541_low_23 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 14 - 257
Target Start/End: Complemental strand, 13307388 - 13307146
Alignment:
| Q |
14 |
agagcatagatggagagattaatatgttaagctatggtgcatgaagactgtgttttggatctatttgaatgaaaaatcagataattttgcacgttattga |
113 |
Q |
| |
|
|||||||| |||||| || |||| ||||||||| ||||||||||||||||||||||||| | |||||||||||||||| |||||||||||| |||| ||| |
|
|
| T |
13307388 |
agagcatatatggagggaataatttgttaagctgtggtgcatgaagactgtgttttggacc-atttgaatgaaaaatcggataattttgcatgttaatga |
13307290 |
T |
 |
| Q |
114 |
agttcatctgaatacttgaactttacatcctttttggataatttctagagtttaacatcggtctgcactgattacaatatttcattactgttccttgaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13307289 |
agttcatctgaatacttgaactttacatcctttttggataatttctagagtttaacatcggtctgcactgattacaatatttcattactgttccttgaat |
13307190 |
T |
 |
| Q |
214 |
ttaatatgtttcactatatatttaaacagatcagtgcaggagca |
257 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
13307189 |
ttaatatgtttcactatgtatttaaacagattagtgcaggagca |
13307146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University