View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10541_low_26 (Length: 252)
Name: NF10541_low_26
Description: NF10541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10541_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 43184656 - 43184901
Alignment:
| Q |
1 |
ttttaagaagcatgtagagacagtgtaaattaagtatgttgcctttctcaaagcgatcgcctctttccctatttctagggtttgaggttcataatatttg |
100 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184656 |
ttttaagaagcatgtggaaacagtgtaaattaagtatgttgtctttctcaaagcgatcgcctctttccctatttctagggtttgaggttcataatatttg |
43184755 |
T |
 |
| Q |
101 |
ccactgttgaaaagccaatacaaggccattaatttgatcatgaggg--------atgttttagagagagtgtgtgtagaatcaaagctaaaagtatgatt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184756 |
ccactgttgaaaagccaatacaaggccattaatctgatcatgagggatttagacatgttttagagagagtgtgtgtagaatcaaagctaaaagtatgatt |
43184855 |
T |
 |
| Q |
193 |
aaatgcggagtaatactagcactacttatttgacttgaccacttcc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43184856 |
aaatgcggagtaatactagcactacttatttgacttgaccacttcc |
43184901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University