View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10541_low_36 (Length: 238)
Name: NF10541_low_36
Description: NF10541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10541_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 38101594 - 38101816
Alignment:
| Q |
1 |
ttatttgaaagaagaaatatataaactgaaattgcaagttttcaaaaaagatggtttttgtcatttctcttctaacactgaatgcacttctttctttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38101594 |
ttatttgaaagaagaaatatataaactgaaattgcaagttttcaaaaaagatggtttttgtcatttctcttctaacactgaatgcacttctttctttctt |
38101693 |
T |
|
| Q |
101 |
ttgactggggatttattatggtggcttttacttgactttgatcatcaagaatagtcccttattaggtagtatgtcttcatgtctgatgttatggcagtat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38101694 |
ttgactggggatttattatggtggcttttacttgactttgatcatcaagaatagtcccttattaggtagtatgtcttcatgtctgatgttatggcagtat |
38101793 |
T |
|
| Q |
201 |
tgtatttgctcctttatgaaagt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38101794 |
tgtatttgctcctttatgaaagt |
38101816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 119 - 223
Target Start/End: Complemental strand, 300748 - 300644
Alignment:
| Q |
119 |
tggtggcttttacttgactttgatcatcaagaatagtcccttattaggtagtatgtcttcatgtctgatgttatggcagtattgtatttgctcctttatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
300748 |
tggtggcttttacttgactttgatcatcaagaatagtcccttattaggtagtatgtcttcatgtctgatgttatggcagtattgtatttgctcctttatg |
300649 |
T |
|
| Q |
219 |
aaagt |
223 |
Q |
| |
|
||||| |
|
|
| T |
300648 |
aaagt |
300644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University