View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10541_low_42 (Length: 222)
Name: NF10541_low_42
Description: NF10541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10541_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 35 - 207
Target Start/End: Original strand, 51468044 - 51468216
Alignment:
| Q |
35 |
gaagaatctatgaacgattttcgggtactggcttggctagccatgttggcaaatttttgtgccaaagtaggaccgccaccactaccaccaattgataaaa |
134 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51468044 |
gaagaatctatgaatgattttcgggtactggcttggctagccatgttggcaaatttttgtgccaaagtaggaccgccaccaccaccaccaattgataaaa |
51468143 |
T |
|
| Q |
135 |
gcgtcttcaccgaattactctttgactgaatggtttcagtgaaggttgagaaactagctgcgtgtgtagaaga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51468144 |
gcgtcttcaccgaattactctttgactgaatggtttcagtgaaggttgagaaactagctgcgtgtgtagaaga |
51468216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 70 - 197
Target Start/End: Original strand, 51482989 - 51483113
Alignment:
| Q |
70 |
gctagccatgttggcaaatttttgtgccaaagtaggaccgccaccactaccaccaattgataaaagcgtcttcaccgaattactctttgactgaatggtt |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||| | |||||||||||||| ||| || ||||| ||| |||| |||| ||||| ||| |
|
|
| T |
51482989 |
gctagccatgttggcatatttttgtgccaaagtagga---ccacccccaccaccaattgatagaagggttttcactgaactactttttgcctgaacagtt |
51483085 |
T |
|
| Q |
170 |
tcagtgaaggttgagaaactagctgcgt |
197 |
Q |
| |
|
| |||||||||||||| || ||||||| |
|
|
| T |
51483086 |
tgggtgaaggttgagaatcttgctgcgt |
51483113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 126 - 196
Target Start/End: Original strand, 51457821 - 51457891
Alignment:
| Q |
126 |
ttgataaaagcgtcttcaccgaattactctttgactgaatggtttcagtgaaggttgagaaactagctgcg |
196 |
Q |
| |
|
|||||||||| || ||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51457821 |
ttgataaaagggttttcactgaacgactctttgcctgaatggtttcagtgaaggttgagaaactagctgcg |
51457891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 35 - 207
Target Start/End: Original strand, 48424463 - 48424629
Alignment:
| Q |
35 |
gaagaatctatgaacgattttcgggtactggcttggctagccatgttggcaaatttttgtgccaaagtaggaccgccaccactaccaccaattgataaaa |
134 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| | ||||||| || ||||||||| | | |||||| ||||||||||||| |
|
|
| T |
48424463 |
gaagaatctatgaaagattttcgtctactggcttggctagccatatcagcaaattgttttgccaaagttgaattcccacca------ccaattgataaaa |
48424556 |
T |
|
| Q |
135 |
gcgtcttcaccgaattactctttgactgaatggtttcagtgaaggttgagaaactagctgcgtgtgtagaaga |
207 |
Q |
| |
|
| || ||||||||| ||||||||| ||| || ||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
48424557 |
gagttttcaccgaactactctttgcctggattgtttcagtgaaggttgagaaactagctgcgtttgcagaaga |
48424629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University