View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10541_low_46 (Length: 206)
Name: NF10541_low_46
Description: NF10541
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10541_low_46 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 45 - 190
Target Start/End: Complemental strand, 20387562 - 20387417
Alignment:
| Q |
45 |
gcaaagcattagaggatcaaagatgcttacttgcataaactaacaaaacacaaagtatcattgtaattgtaaaacgaggtttaaacgtgcaattgcatat |
144 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
20387562 |
gcaaagcattagaggatcaaggatgcttacttgcataaactaacaaaacacaaagtatcattgtaattgtaaaacgaggattaaacgtgcaattgcatac |
20387463 |
T |
|
| Q |
145 |
cattagcgtaaagtttagcggagagatatttgacagtatgatgaag |
190 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20387462 |
ctttagcgtaaagtttagcggagagatatttgacagtatgatgaag |
20387417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Original strand, 32695343 - 32695392
Alignment:
| Q |
141 |
atatcattagcgtaaagtttagcggagagatatttgacagtatgatgaag |
190 |
Q |
| |
|
||||| ||||| ||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32695343 |
atatctttagcataaagttcagcggagagatatttgacagcatgatgaag |
32695392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 189
Target Start/End: Complemental strand, 19334336 - 19334294
Alignment:
| Q |
147 |
ttagcgtaaagtttagcggagagatatttgacagtatgatgaa |
189 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
19334336 |
ttagcgtaaagttcagcggaaagatatttgacagcatgatgaa |
19334294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University