View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10542_high_5 (Length: 280)
Name: NF10542_high_5
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10542_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 64 - 273
Target Start/End: Complemental strand, 6475986 - 6475778
Alignment:
| Q |
64 |
aaatgtgaatttcggttttggttttgggttttgatgttacgtttgtattgcattattttgcggtagattgaatgaatgctccatgttttctacaactggc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6475986 |
aaatgtgaatttcggttttggttttgggttttgatgttacgtttgtattgcattattttgcggtagattgaatgaatgctccatgttttctacaactggc |
6475887 |
T |
|
| Q |
164 |
attttgtaatcaatggttagttaacttaactatagttacttacttactactagtcgtgttagttgtttgttggtggttatatgatggtggtatggtttac |
263 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6475886 |
attttgtaatc-atggttagttaacttaactatagttacttacttactactagtcttgttagttgtttgttggtggttatatgatggtggtatggtttac |
6475788 |
T |
|
| Q |
264 |
tcgatctgtt |
273 |
Q |
| |
|
|||||||||| |
|
|
| T |
6475787 |
tcgatctgtt |
6475778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University