View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10542_high_5 (Length: 280)

Name: NF10542_high_5
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10542_high_5
NF10542_high_5
[»] chr1 (1 HSPs)
chr1 (64-273)||(6475778-6475986)


Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 64 - 273
Target Start/End: Complemental strand, 6475986 - 6475778
Alignment:
64 aaatgtgaatttcggttttggttttgggttttgatgttacgtttgtattgcattattttgcggtagattgaatgaatgctccatgttttctacaactggc 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6475986 aaatgtgaatttcggttttggttttgggttttgatgttacgtttgtattgcattattttgcggtagattgaatgaatgctccatgttttctacaactggc 6475887  T
164 attttgtaatcaatggttagttaacttaactatagttacttacttactactagtcgtgttagttgtttgttggtggttatatgatggtggtatggtttac 263  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
6475886 attttgtaatc-atggttagttaacttaactatagttacttacttactactagtcttgttagttgtttgttggtggttatatgatggtggtatggtttac 6475788  T
264 tcgatctgtt 273  Q
    ||||||||||    
6475787 tcgatctgtt 6475778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University