View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10542_low_18 (Length: 272)
Name: NF10542_low_18
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10542_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 202 - 257
Target Start/End: Original strand, 6175405 - 6175461
Alignment:
| Q |
202 |
ctaacttccatcaattgaaggtgctaacttt-gtttgatatctcagtttcggtctct |
257 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6175405 |
ctaacttccatcaattgaaagtgctaacttttgtttgatatctcagtttcggtctct |
6175461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University