View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10542_low_23 (Length: 241)
Name: NF10542_low_23
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10542_low_23 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 40960484 - 40960263
Alignment:
| Q |
19 |
gcaaggaacgacaaaatcttcggttttaaagcatctaaagtgccggaggttgtagaggcgataaaaagtttgtcttggagtttgtttttggggaagaatt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40960484 |
gcaaggaacgacaaaatcttcggttttaaagcatctaaagtgccggaggttgtagaggcgataaaaagtttgtcttggagtttgttttt-gggaagaatt |
40960386 |
T |
|
| Q |
119 |
cgggtccaccttgcctcttttacaaatggtttacattgtatgcttaggtaatttagtggtgtttgtttagttggttagannnnnnngggagggtcgagta |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40960385 |
cgggtccaccttgcctcttttacgaatggtttacattgtatgcttaggtaatttagtggtgtttgtttagttggttagatttttttgggagggtcgagta |
40960286 |
T |
|
| Q |
219 |
ctacttgtacttaatagcaatgc |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40960285 |
ctacttgtacttaatagcaatgc |
40960263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University