View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10542_low_24 (Length: 240)
Name: NF10542_low_24
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10542_low_24 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 74 - 240
Target Start/End: Complemental strand, 1361732 - 1361563
Alignment:
| Q |
74 |
ctcaattttgaacggaaatcaccaaagtttaaaagaaatatcaacctgcataatagtaacacggttattcacatttccaacaca------aaaagtaaaa |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1361732 |
ctcaattttgaacggaaatcaccaaagtttaaaagaaatatcaacctgcataatagtaacacggttattcacatttccaacacaaaaaccaaaagtaaaa |
1361633 |
T |
 |
| Q |
168 |
atattcacatttctgcaacataatagtaagatattgaatatggcatgccaataaaatatttccatgtaattat |
240 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1361632 |
atattcacatttctg---cataatagtaagatattgaatatggcatgccaataaaatatttccatgtaattat |
1361563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 1361790 - 1361753
Alignment:
| Q |
17 |
aatgttgcatctaaatatttgttttaaattttctgaag |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1361790 |
aatgttgcatctaaatatttgttttaaattttctgaag |
1361753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University