View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10542_low_30 (Length: 227)
Name: NF10542_low_30
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10542_low_30 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 62 - 227
Target Start/End: Complemental strand, 43980907 - 43980742
Alignment:
| Q |
62 |
actagaactatagcgcgagtgcgagggagggacaaatttatatacatatgggtcccattgccacgtggctcattttgccacgttggatcataaggtcttt |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43980907 |
actagaactatagcgcgagtgcgagggagggacaaatttatatacatatgggtcccattgccacgtggctcattttgccacgttggatcataaggtcttt |
43980808 |
T |
 |
| Q |
162 |
tgctgttatataaacgaccatagtttcatcatctctccctttcactttcctgcccaattaatgcac |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43980807 |
tgctgttatataaacgaccatagtttcatcatctctccctttcactttcctgcccaattaatgcac |
43980742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 43980960 - 43980923
Alignment:
| Q |
1 |
aaagatgtgtttggttttggttacaaagccgataagaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43980960 |
aaagatgtgtttggttttggttacaaagccgataagaa |
43980923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University