View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10542_low_33 (Length: 220)
Name: NF10542_low_33
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10542_low_33 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 13140397 - 13140189
Alignment:
| Q |
16 |
caaaatgagaatatgtacttgattttacagttgtttgctctatttgtagatttttagatggacgataaatatgggcattttgacga----atttactcaa |
111 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13140397 |
caaaatgagaatatgtacttgatttgatagttgtttgctctatttgtagatttttagatggacgataaatatgggcattttgacgaaagcatttactcaa |
13140298 |
T |
|
| Q |
112 |
agtttgggaaggagataagcgaataatttgatttaaggcgggannnnnnnncatttggtagaaattttggcagctcatgcatggtgtagcaaagatatgt |
211 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
13140297 |
agttcgggaaggagataagcgaataatttgatttaaggagggattttttttcatttggtagaaattttggcagctcatgcatggtgtagcaaatagatgt |
13140198 |
T |
|
| Q |
212 |
gcttatgac |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
13140197 |
gcttatgac |
13140189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University