View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10542_low_36 (Length: 216)
Name: NF10542_low_36
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10542_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 6533433 - 6533250
Alignment:
| Q |
18 |
agactttatgatttcttttatgcttcctcgggatttgctcttgaggaagcagagcgtttgggtgtttcaaaagaggaggcttgtcataatctattattcg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6533433 |
agactttatgatttcttttatgcttcctcgggatttgctcttgaggaagcagagcgtttggatgtttcaaaagaggaggcttgtcataatctattattcg |
6533334 |
T |
 |
| Q |
118 |
caacatgttttaattcttttggcgggatgaagctgtttttccctaatttgatgaaatggatcgggcgcggtggagtgaggttgc |
201 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6533333 |
caacatgttttaattcgtttggcgggatgaagctgtttttccctaatttgatgaaatggatcgggcgcggtggagtgaggttgc |
6533250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 178
Target Start/End: Complemental strand, 52112661 - 52112584
Alignment:
| Q |
101 |
tcataatctattattcgcaacatgttttaattcttttggcgggatgaagctgtttttccctaatttgatgaaatggat |
178 |
Q |
| |
|
||||||||| ||||| || |||||||||||||| ||||| ||||||||| | ||||| ||||||||| |||| ||||| |
|
|
| T |
52112661 |
tcataatcttttatttgccacatgttttaattcatttggtgggatgaagattttttttcctaatttgttgaagtggat |
52112584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University