View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10542_low_36 (Length: 216)

Name: NF10542_low_36
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10542_low_36
NF10542_low_36
[»] chr1 (1 HSPs)
chr1 (18-201)||(6533250-6533433)
[»] chr3 (1 HSPs)
chr3 (101-178)||(52112584-52112661)


Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 18 - 201
Target Start/End: Complemental strand, 6533433 - 6533250
Alignment:
18 agactttatgatttcttttatgcttcctcgggatttgctcttgaggaagcagagcgtttgggtgtttcaaaagaggaggcttgtcataatctattattcg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
6533433 agactttatgatttcttttatgcttcctcgggatttgctcttgaggaagcagagcgtttggatgtttcaaaagaggaggcttgtcataatctattattcg 6533334  T
118 caacatgttttaattcttttggcgggatgaagctgtttttccctaatttgatgaaatggatcgggcgcggtggagtgaggttgc 201  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6533333 caacatgttttaattcgtttggcgggatgaagctgtttttccctaatttgatgaaatggatcgggcgcggtggagtgaggttgc 6533250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 101 - 178
Target Start/End: Complemental strand, 52112661 - 52112584
Alignment:
101 tcataatctattattcgcaacatgttttaattcttttggcgggatgaagctgtttttccctaatttgatgaaatggat 178  Q
    ||||||||| ||||| || |||||||||||||| ||||| ||||||||| | ||||| ||||||||| |||| |||||    
52112661 tcataatcttttatttgccacatgttttaattcatttggtgggatgaagattttttttcctaatttgttgaagtggat 52112584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University