View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10542_low_9 (Length: 340)
Name: NF10542_low_9
Description: NF10542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10542_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 18 - 330
Target Start/End: Original strand, 17549482 - 17549794
Alignment:
| Q |
18 |
gaagacgaagcaaagaagcagccattcgaatctcttcatttattgcattaagaacctctcttctaactattgtaaaaacatcagggcacgttgtcctgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17549482 |
gaagacgaagcaaagaagcagccattcgaatctcttcatttattgcattaagaacctctcttctaactattgtaaaaacatcagggcacgttgtcctgta |
17549581 |
T |
|
| Q |
118 |
aaaatatggggtcagtttagggctaataggttcagccacactcaaatttaagaaactcataagccaaaaacatgcaatagctttgcatgatttattcatt |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
17549582 |
aaaatatggggtcagtttagggctcataggttcagccacactcaaatttaagaaactcataagccaaaaacatgcaatagctctacatgatttattcatt |
17549681 |
T |
|
| Q |
218 |
tttgctttgtttgttactaagttagatgtatttggcaaatacctaacaatggatgtatttatagccaccaaatgaaacatagagaaattttttattgaat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17549682 |
tttgctttgtttgttactaagttagatgtatttggcaaatacctaacaattgatgtatttatagccaccaaatgaaacatagagaaattttttattgaac |
17549781 |
T |
|
| Q |
318 |
gtataatcctttg |
330 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17549782 |
gtataatcctttg |
17549794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University