View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10543_low_3 (Length: 306)
Name: NF10543_low_3
Description: NF10543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10543_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 288
Target Start/End: Original strand, 302457 - 302711
Alignment:
| Q |
18 |
acagtatgcaatgatcgacacattttggcctagccttgttctgttctacaattcccctattcaattggtatatagagaatgggtattaaataatcatgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
302457 |
acagtatgcaatgatcgacacattttggcctagccttgttctgttctacaattcccctattcaattggtatatggagcatgggtattaaataatcatgct |
302556 |
T |
|
| Q |
118 |
gctgtgtatgggaatattggatttatgatattggattctatacctaactttcctaactgctggttagtagtcacacttgtgtcttcaaataggtacactg |
217 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
302557 |
gctgt--atgggaatat--------------tggattctatacctaactttcctaactgctggttagtagtcacacttgtgtcttcaaataggtacactg |
302640 |
T |
|
| Q |
218 |
tctatattagatgatgtagtaacgtaggatgtataccttgcttgtaacagagacagttgtgtctgtgctcc |
288 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
302641 |
tctatattagatgatgtagtaacgtagtatgtataccttgcttgtaacagagactgttgtgtctttgctcc |
302711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University