View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10544_low_2 (Length: 218)
Name: NF10544_low_2
Description: NF10544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10544_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 90 - 200
Target Start/End: Original strand, 25903230 - 25903339
Alignment:
| Q |
90 |
cacaaattgcttattctaaatggtgacactttttggattatgaaagccgaaatattgtaaggggtttatgatttatataatccgaaatacatgttttact |
189 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25903230 |
cacaaattgct-attctggatggtgacacttttcggattatgaaagctgaaatattgtaaggggtttatgatttatataatccgaaatacatgttttact |
25903328 |
T |
|
| Q |
190 |
gagactaatac |
200 |
Q |
| |
|
|||||||||| |
|
|
| T |
25903329 |
aagactaatac |
25903339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University