View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10545_high_12 (Length: 201)
Name: NF10545_high_12
Description: NF10545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10545_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 23 - 188
Target Start/End: Complemental strand, 31529315 - 31529150
Alignment:
| Q |
23 |
tccagtgtttctgtgcaacaattcagacatttatgttagggaagatcaatagaatttgaagaactgattaaaagttagtggaaaatatgcatttgatgaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31529315 |
tccagtgtttctgtgcaacaattcagacatttatgttagggaagatcaatagaatttgaagaactgattaaaagttagtggaaaatatgcatttgatgaa |
31529216 |
T |
 |
| Q |
123 |
gtaattttaagaactggttcgttgcttacactttttggttttcaatggcttcatgtaataatctct |
188 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31529215 |
gtaattttaagaactgattcgttggttacactttttggttttcaatggcttcatgtaataatctct |
31529150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University