View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10545_high_5 (Length: 247)

Name: NF10545_high_5
Description: NF10545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10545_high_5
NF10545_high_5
[»] chr4 (1 HSPs)
chr4 (13-227)||(43513983-43514197)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 43513983 - 43514197
Alignment:
13 gagacacttgtgattatattcaataatgtcctctacattcgacatggatcaatgtcaaacacagacatacgtggttaaattcaataatatcatttctaca 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||    
43513983 gagaaacttgtgattatattcaataatgtcctctacattcgacatggatcagtgtcaaacacaaacatacatggttaaattcaataatatcatttctaca 43514082  T
113 tagatcaatatgtcactgttgtggctgatgaacgtgtcattgattgatgaattaagagtgcttaaattgaaagtttggtgggatgataaacaaacctgag 212  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
43514083 tagatcaatatgtcactgttgtgtctgatgaacgtgtcattgattgatgaattaagagtgcttaaattgaaagtttggtgagatgagaaacaaacctgag 43514182  T
213 aaagaaatgggtgga 227  Q
    |||||||||||||||    
43514183 aaagaaatgggtgga 43514197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University