View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10545_low_10 (Length: 254)
Name: NF10545_low_10
Description: NF10545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10545_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 245
Target Start/End: Complemental strand, 5005544 - 5005306
Alignment:
| Q |
7 |
gaggtggccaaaagggcaatgttgggtgtccttgctgtggatgcggtaactgtgtccatggtgtttgtgtggtatattgagggttataaggccattgaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5005544 |
gaggtggccaaaagggcaatgttgggtgtccttgctgtggatgcggtaactgtgtccatgatgtttgtgtggcatattgagggttataaggccattgaaa |
5005445 |
T |
|
| Q |
107 |
cattgatggttgttggtggtgctgatttaagttaggcatattgtcatatgaaggactattactgtcgctgctggtaatatggctcatagtcatatttgtc |
206 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5005444 |
cattgatggttattggtggtgctgatttgagttaggcatattgtcatatgaaggactattactgccgctgctggtaatatggctcatagtcatatttgtc |
5005345 |
T |
|
| Q |
207 |
tcagttttgtcttgcgtgttctgctaatcatattcatct |
245 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5005344 |
tcagttttgtcctgcgtgttctgctaatcatattcatct |
5005306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University