View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10545_low_12 (Length: 251)
Name: NF10545_low_12
Description: NF10545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10545_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 31528956 - 31528720
Alignment:
| Q |
1 |
tccaaatattcgcaaaatggcatatgggattttcaccacgtttatacttggtaggttagtggaggtttataggtcttctaatttgaagggttttcaaact |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
31528956 |
tccaaatattcgcaaaacggcatatgggattttcaccacgtttatacttggcaggttaatggaggtttataggtcttctaatttaaagagttttcaaact |
31528857 |
T |
 |
| Q |
101 |
tgtcttatattgtccgattaactaaaaaatttctccaattgataaactatttcataatttataacaattataaaatatgtaattaannnnnnnnagta-c |
199 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
31528856 |
tgtcttatattgtctgattaactaaaaaaattctccaattgataaactatttcataatttataacaattataaaatatgtaattaattttttttagtacc |
31528757 |
T |
 |
| Q |
200 |
ctcctgaactttttagtcaaactttaacacttcaact |
236 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
31528756 |
ctcctgaactttttagccaaactttgacacttcaact |
31528720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University