View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10545_low_13 (Length: 250)
Name: NF10545_low_13
Description: NF10545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10545_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 42291179 - 42290939
Alignment:
| Q |
1 |
ttaataatttatgcttctcttcttcnnnnnnnntaatttatgcttctccaatgt-atattacaagaatctaaaaatgtttttggagtcaaacttagtttg |
99 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42291179 |
ttaataatttatgcttctcttcttcaaaaaaaatagtttatgcttctccaatgttatattacaagaatctaaaaatgtttttggagccaaacttagtttg |
42291080 |
T |
|
| Q |
100 |
gccaacaaatatgatgagtccctaataaaaacaaatcaaatgagtgctccaaactccaaacataaagtaaatattattttgctctagatacgcttgtttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42291079 |
gccaacaaatatgatgagtccctaataaaaacaaataaaatgagtgcaccaaactccaaacataaagtaaatattattttgctctagatacgcttgtttg |
42290980 |
T |
|
| Q |
200 |
actcaaaacatgtgccaatattattaaggatagtctctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42290979 |
actcaaaacatgtgccaatattattaaggatagtctctctg |
42290939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University