View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10545_low_14 (Length: 247)
Name: NF10545_low_14
Description: NF10545
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10545_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 227
Target Start/End: Original strand, 43513983 - 43514197
Alignment:
| Q |
13 |
gagacacttgtgattatattcaataatgtcctctacattcgacatggatcaatgtcaaacacagacatacgtggttaaattcaataatatcatttctaca |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43513983 |
gagaaacttgtgattatattcaataatgtcctctacattcgacatggatcagtgtcaaacacaaacatacatggttaaattcaataatatcatttctaca |
43514082 |
T |
 |
| Q |
113 |
tagatcaatatgtcactgttgtggctgatgaacgtgtcattgattgatgaattaagagtgcttaaattgaaagtttggtgggatgataaacaaacctgag |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
43514083 |
tagatcaatatgtcactgttgtgtctgatgaacgtgtcattgattgatgaattaagagtgcttaaattgaaagtttggtgagatgagaaacaaacctgag |
43514182 |
T |
 |
| Q |
213 |
aaagaaatgggtgga |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43514183 |
aaagaaatgggtgga |
43514197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University